
ПЦР не обнаруживает SARS-CoV-2

О праймерах

Генетические последовательности, используемые в ПЦР для выявления SARS-CoV-2 и диагностики случаев болезни и смерти, приписываемых Covid-19, присутствуют в десятках последовательностей человеческого генома и примерно сотни микроорганизмов.

То же самое справедливо в отношении праймеров, наиболее обширных фрагментов, выбранных случайным образом из предполагаемых «геномов» и даже так называемые «генов-мишеней», якобы специфичных для «нового коронавируса ». Тест бесполезен, и все «положительные» результаты, полученные до сих пор, должны быть признаны недействительным с научной точки зрения, о чем необходимо известить пострадавших, а в случае смерти последних — их родственников. Стивен Бастин, один из ведущих мировых экспертов по ПЦР, фактически заявляет, что при определенных условиях тест может оказаться положительным у любого человека!

Мы предупреждаем вас с марта месяца: специфические тесты для выявления вируса невозможны, если неизвестны компоненты вируса, который тест должен обнаруживать. А компоненты не могут быть известны без предварительного выделения / очистки этого вируса. С тех пор мы продолжаем копить всё больше доказательств, что никто не выделил вирус SARS-CoV-2 и, что ещё важнее, он не может быть выделен в принципе по причинам, которые мы описали в прошлом месяце (отчет « Можете ли вы доказать, что патогенные вирусы существуют?» на нашем сайте www.dsalud.com). В настоящем отчете мы представим новые данные, свидетельствующие, что ОТ-ПЦР обнаруживает не SARS-CoV-2, как его сейчас представляют, а фрагменты РНК человека и многих микробов.

Мы уже упоминали многочисленные проблемы, связанные с ПЦР, что признано организациями или правительствами, такими как ВОЗ или CDC, а также авторитетными международными экспертами, такими как доктор Стивен Бастин, который считает произвольность в выборе критериев оценки результатов теста и числа циклов нонсенсом, поскольку по такой логике можно получить положительный результат у кого угодно.

В этот отчет добавлены результаты конкретного исследования, которое мы провели на основе данных, опубликованных о предполагаемом SARS-CoV-2, протоколов, одобренных ВОЗ для использования ОТ-ПЦР, а также данных по остальным «коронавирусам человека». И выводы крайне серьезные: ни один из семи «человеческих коронавирусов» на самом деле никогда не был выделен, а все последовательности праймеров для соответствующих ПЦР и множества фрагментов их предполагаемых геномов обнаруживаются в различных областях человеческого геном и в геномах бактерий и архей, таких как эти: Shwanella marina JCM, Dialistersuccinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis,Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis,Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale,Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacilluapanacisegetis, Ru bacter ruber, Skemania piniformis, Chryseobacterium shigense, Caloramatorpeoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis и многие другие.

Мы собираемся пошагово объяснить исследование, которое привело нас к такому необычному выводу.


В первой половине апреля, когда наше первое исследование показало, что SARS-CoV-2 выделен не был, а те, кто утверждал обратное, ссылались на «изоляты» предыдущих «коронавирусов человека», мы приступили к тщательному анализу заявленных изолятов. А именно, мы изучили публики по заявленному выделению предполагаемых человеческих коронавирусов 229E (якобы выделенного в 1965 г.), OC43 (1967 г.), SARS-CoV (2003 г.), NL63 (2004 г.), HKU1 (2005 г.) и MERSCoV (2012 г.).

И вот результаты:

Коронавирус 229E

Первоисточник: Dorothy Hamre, John Procknow. Новый вирус, выделенный из дыхательных путей человека. (A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1: 190-193. January 1, 1966.) Поскольку авторы ссылаются на другие статьи, где описан метод выделения — который они называют реакцией фиксации комплемента, – мы обратились к справочной статье по этому методу: Janet W. Hartley et al. Реакция фиксации комплемента и анализ тканевой культуры на вирусы лейкемии мышей (Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5): 931-938, May 1965. PNAS, 53 (5):931-938, May 1965). Эта процедура уже не применяется, в ней используется реакция антиген-антитело для выявления одного или другого. В нашем случае цель состояла в обнаружении антигенов предполагаемого нового вируса, но, как мы уже объясняли, для этого необходимы специфические антитела, которые невозможно получить при самом первом обнаружении вируса.

Коронавирус OC43

Первоисточник: Paul Lee. Молекулярная эпидемиология коронавируса человека OC43 в Гонконге ( Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub). То, что сочли вирусной РНК, было извлечено из культур без каких-либо доказательств того, что РНК принадлежит именно вирусу. Используемый инструмент – набор QIAamp – удаляет реагенты, ингибиторы и загрязняющие вещества, но не способен различить, откуда берется извлеченная РНК. А также отсутствуют контроли. Затем провели амплификацию методом ПЦР и секвенироввание, исходя из предположения (!), что генетическая информация относится к вирусу. Наконец, автор рассуждают о мутациях, рекомбинациях, генотипах, молекулярная эволюция, штаммах и других профессиональных заморочках, как бы отражающих – не доказанную, – что исследован «вирус».

Коронавирус SARS-CoV

Первоисточник: J. S. M. Peiris et al. Коронавирус как возможная причина ОРВИ (Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003).

В статье ничего не упоминается об очистке. Нет даже упоминаний о фильтрации или центрифугировании. Утверждается лишь, что «вирусы были выращены в клетках печени эмбриона обезьяны из носоглоточного аспирата и биоптатов легочной ткани двух пациентов». Контроли отсутствуют. Единственное — упоминается «цитопатический эффект», который приписывается вирусу, и что ПЦР для выявления известных вирусов и ретровирусов результатов не дала. Наконец, была проведена ОТ-ПЦР со «случайными праймерами», и обнаружилась последовательность «неизвестного происхождения», проявившая «слабую гомологию с семейством coronaviridiae». Затем разработали праймеры для этой последовательности, и при тестировании 44 проб от пациентов с SARS (тяжелый острый респираторный синдромом, она же атипичная пневмония) только 22 оказались положительными.

Коронавирус NL63

Первоисточник: Lia van der Hock et al. Обнаружение нового коронавируса человека (Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004).

Авторы заявляют, что «идентификация неизвестных патогенов с помощью инструментов молекулярной биологии является трудной задачей, поскольку целевая последовательность неизвестна, поэтому специфичные праймеры для ПЦР сконструировать невозможно». Они использовали метод, ими же разработанный под названием VIDISCA, который, по их утверждению, не требует предварительного знания последовательности! Как такое возможно? Посмотрим, как это работает: сначала готовят культуру и исходят из допущения, при присутствие вируса доказывает «цитопатический эффект». Новизна метода состоит в том, что добавляют «рестриктазы» — ферменты, разрезающие молекулы нуклеиновых кислот в определенных местах и всегда одинаковой длины.

Таким образом, если после разрезания рестриктазами получается множество фрагментов одинаковых или очень схожих ДНК или РНК, авторы делают вывод, что источником фрагментов является вирус, поскольку геном хозяина будет разрезан на различные случайные отрезки, в то время как геном вируса представляет собой большое количество одинаковых копий, одинаковых ввиду репликация вируса. Верен ли такой вывод?!?!

Конечно, нет!
Это допущение (которое добавляется к предыдущему допущению, что имеется вирус) не учитывает существование «вирусоподобных частиц», «ретровирусоподобных частиц», «эндогенных ретровирусов», «экзосом», «внеклеточных» частиц и даже митохондриальной ДНК. Игнорируется, что существует множество частиц, обладающих теми же репродуктивными характеристиками в больших количествах, что и «вирусы» и, следовательно, можно фальсифицировать результаты, получая большое количество идентичных копий при разрезании ферментами, как признано в статье о методике VIDISCA Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery, опубликованной 2 апреля 2019 г. в томе 263 «Virus Research», где авторы — Cormac M. Kinsella et al . —признают, что «избыточность во вставке VIDISCA из фоновой нуклеиновой кислоты хозяина не ожидается, за исключением случай «вирусоподобных» характеристик, например, большого числа копий, как в митохондриальной ДНК.

Коронавирус HKU1

Первоисточник: Patrick C. Y. Woo et al. Характеристики и полноразмерная геномная последовательность нового коронавируса HKU1, обнаруженного у пациентов с пневмонией (Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005).

Невероятно, но статья начинается с слов: «Несмотря на обширные исследования пациентов с инфекциями дыхательных путей, у значительной доли пациентов микробные причины не обнаружены. РНК извлекают из неочищенных культур». И используют ПЦР для выявления генов коронавирусов. Для секвенирования использованы две базы данных белков, организованных в семейства, домены. и функциональные сайты —PFAM и INterProScan — с двумя компьютерными программами, которые содержат наши «прогнозы» о том, как должны сочетаться нуклеотиды. В тексте добавлено: «Последовательности собраны и отредактированы вручную для получения окончательной последовательности вирусного генома» . И снова отсутствуют контроли.

Коронавирус MERS-CoV

Первоисточник: Ali Moh Zaki et al. Выделение нового коронавируса у мужчины с пневмонией в Саудовской Аравии (Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012).

Генетический материал извлечен прямо из супернатанта культуры и образца мокроты методом High Puré Viral Nucleic Acid Kit, а затем протестирован с помощью различных ПЦР на различные известные микроорганизмы. Нет упоминания об очистке, и отсутствуют контроли. Короче говоря, что сделано с первыми коронавирусами (и многими другими предполагаемыми вирусами): 1) культивирование якобы инфицированных тканей, когда любой «цитопатический эффект» приписывается исключительно вирусу; 2) затем либо получение неких белков, назначенных «вирусными антигенами» без дополнительных исследований, и когда эти «антигены» обнаруживаются в культурах, это интерпретируется как «выделение»; или 3) извлечение фрагментов нуклеиновых кислот, исходя из допущения, что они принадлежат вирусу.

В статье, опубликованной в предыдущем номере журнала, мы уже объясняли, что согласно доктору Стефану Ланке, так называемый «цитопатический эффект» на самом деле является эффектом, вызванным условиями культивирования как таковыми. Это признано, например, в статье «Высвобождение мелких внеклеточных везикул (экзосом) с поверхностно-ассоциированной ДНК, вызванной антибиотиками» (Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA), опубликованной 15 августа 2017 г. на сайте Nature за подписью Andrea Németh и другими.


Объясняется, что определенные вещества, такие как антибиотики, добавленные в экспериментах in vitro, могут вызывать стресс в клеточной культуре, поэтому клетки производят новые последовательности, не обнаруженные ранее. Это отмечено не кем иным, как доктором Барбарой МакКлинток в 1983 г. в ееНобелевской лекции.


По сути, НЕ БЫЛ ВЫДЕЛЕН НИ ОДИН ИЗ СЕМИ ПРЕДПОЛАГАЕМЫХ КОРОНАВИРУСОВ ЧЕЛОВЕКА. Единственное, в чем заключались различия — это лабораторные процедуры и методы, которые становились все более изощренными, которые в нашем случае подразумевает не большую точность, а большую способность к обману и самообману , что привело к виртуальному производству SARS-CoV-2. И очевидным следствием отсутствия доказательств выделения является то, что «коронавирусы» не могут считаться причиной ни одной болезни. Более того, все тесты — какими бы они ни были, — основанные на предполагаемых компонентах этих «вирусов» (нуклеиновых кислотах или белках) совершенно не годятся как «тесты на инфекцию» и тем более для «диагностики» заболеваний.


В предыдущем выпуске мы уже собрали ответы авторов нескольких статей, которые описали якобы выделение SARS-CoV-2, где они признали, что очистку не проводили, что является завуалированным признанием, что вирус они не выделили. И теперь мы добавим еще одно свидетельство: ответы разных властей — политических и от здравоохранения — из разных стран об очистке и выделении SARS-CoV-2. James McCumiskey, автор книги The Latest Conspiracy: The Biomedical Paradigm, рассказывает нам, что Государственная референсная вирусологическая лаборатории Ирландии, запросил информацию об этом у Дублинского университета, откуда ответили, что «у них нет записей, которые могли бы дать ответ на запрос». На своем запросе настоял директор юридической службы лаборатории, и из университета ответили следующим образом: «Позиция университета такова, что материалы академических дебатов не могут подпадать под действие Закона о свободе информации “. Это следует из запроса NVR о том, что они не культивировали SARS-CoV-2 и не очищали его. Они лишь подтвердили, что «в диагностических образцах обнаружил РНК SARS-CoV-2».

22 июня группа экспертов направила аналогичный запрос премьер-министру Великобритании Борису Джонсону. Письмо подписали доктор Kevin Corbett, Piers Corbyn (профессор Императорского. Лондонского колледжа, инженер и независимый исследователь, у которого мы брали интервью для журнала), David Crowe, доктор Andrew Kaufman (эдинбургский профессор биологии), Roger Watson и биолог и химик David Rasnick – и по сей день все еще не получил ответ!

На другой подобный запрос — в данном случае в Национальный исследовательский совет Канады — получили следующий ответ: “Нам не удалось провести полный поиск записей NRC поэтому мы с сожалением сообщаем вам, что не было обнаружено записей, отвечающих на ваш запрос ».

Добавим, что два журналиста отправляли аналогичные запросы — в соответствии с Законом о свободе информации — в различные учреждения Канады, Новой Зеландии, Австралии, Германии, Великобритании и США, и по состоянию на 5 сентября ответы прислали двенадцать учреждений, все указывает то же самое: что у них нет записей о работе, описывающей выделение вируса, предположительно являющегося Covid-19. Подробности и ответы можно увидеть на сайте: https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-of-%20covid-19-virus-isolation/


Тогда мы задали себе вопрос: если опубликованные последовательности не принадлежат — как заявлено —- новым вирусам, откуда они берутся? В попытке ответить на это вопрос, мы решили провести поиск с помощью компьютерной программы Basic Local Alignment Инструмент поиска (BLAST), инструмента выравнивания последовательностей, который позволяет сравнивать какую-либо последовательность со всеми последовательностями, хранящимися в Государственных институтах здравоохранения.

США (это общедоступно по адресу:

Пошагово объясняем, что мы сделали, чтобы читатели могли повторить поиск самостоятельно и проверить результаты.

Сначала мы собрали все праймеры для ПЦР, описанные в протоколах, размещенных на сайте ВОЗ на тот момент:

— Протокол CDC Китая: в качестве мишени используются гены ORF1ab и N.

— Протокол Института Пастера (Франция): используются два фрагмента RdRP (как предполагается, специфичные для SARS.CoV-2).

— Протокол CDC США: использует три фрагмента гена N.

— Протокол Государственного института инфекционных болезней Японии: это единственный протокол, где мишенью служат ген S вместе с другими генами, предположительно общими с другими коронавирусами.

— Протокол клиники Шарите ( Германия ): используются гены E, N и RdRP.

— Протокол Гонконгского университета: используются ORF1b-nsp14 и ген N.

— Протокол Национального института здравоохранения Таиланда: используется ген N.

Затем мы ввели последовательность праймеров — того, который указывает начало выявляемой последовательности, и того, что указывает конец — в BLAST для поиска в двух базах данных: коллекции геномов микробов и одной, соответствующий геному человека.


Рассмотрим подробнее процедуру на примере праймеров французского протокола. На сайте BLAST мы выбрали Microbes для поиска в базах данных микробного генома и перешли на следующую страницу. Затем появилась форма, в которой мы ввели последовательность начального праймера французского протокола, то есть ATGAGCTTAGTCCTGTG, выбрали вариант Очень похоже последовательности (Highly similar sequences) и нажали кнопку BLAST . Уже через несколько секунд появились результаты — мы сделали скриншот (рис. 1), появились 100 последовательностей микробов, в частности бактерий и архей, с совпадением от 77% до 100% с процентной долей идентичности 100%.

Затем мы вернулись на главную страницу и во второй раз выбрали Human для поиска в человеческом геноме, затем повторили ту же операцию, и через несколько секунд появился результат, с которого мы снова сделали скриншот (рис. 2). Как оказалось, введенная последовательность совпадает с 74 последовательностями генома человека с совпадением от 66% до 100% и процентом идентичности 100%.

Это указывает на то, что последовательность начального праймера ПЦР, который предположительно является специфическим SARS-CoV-2, фактически соответствует 74 фрагментам генома человека и сотне микробных фрагментов!

Затем мы решили повторить операцию, но с конечным или обратным праймером CTCCCTTTGTGTGTGT, и получили схожие результаты.

Поскольку это были очень короткие последовательности — около двадцати генетических букв или нуклеотидов, — мы решили повторить попытку, но с целевой последовательностью, определенной этими двумя праймерами, то есть последовательностью предполагаемого генома SARS-CoV-2, расположенной между начальным и конечным праймерами. Очевидно, для этого нам нужна последовательность, которая официально заявлена как «геном SARS-CoV-2», и хотя тысячи лабораторий утверждают, что выделили и секвенировали ее (ложное утверждение, что мы объясняли в предыдущих отчетах), мы зашли на сайт Национальный центр биотехнологии:https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903 . Там мы обнаружили «целевую последовательность», фрагмент из 108 нуклеотидов, расположенные между положениями 12 690 и 12 797 «генома», а именно:



Мы повторили описанные ранее шаги, и результаты снова были удивительными, поскольку снова появилась сотня последовательностей микробов с процентом совпадения 100% и четыре последовательности генома человека с процентом идентичности от 83% до 95% [UPD: не воспроизводится, либо ошибка, либо неизвестный паттерн поиска].

Таким образом, совпадений было меньше, но важно то, что мы продолжаем находить фрагменты предполагаемой «целевой последовательности» SARS-CoV-2 как у микробов, так и в нашем собственном геноме. Поистине удивленные, мы сделали следующий шаг и протестировали ген, который в то время считался самым специфичным для SARS-CoV-2 — ген E, который, как предполагается, генерирует белки оболочки и находится между позициями 26 245 и 26 472:


Мы повторили уже описанные шаги, и результат был еще более удивительным, потому что несмотря на его длину, появилась еще сотня микробных последовательностей с процентом идентичность 100% и 10 последовательностей генома человека с процентом идентичности от 80% до 100%. И аналогичныерезультаты были получены с фрагментом, выбранным случайным образом и с геном N, который, как заявляют, соответствует белкам нуклеокапсида SARS-CoV-2.

Затем мы решили протестировать ген S, который, как утверждается, генерирует структурные белки «шипов». являющимися ключевыми для проникновения в клетку, и впоследствии признан наиболее специфичным геном SARS CoV-2. Поскольку это ген, последовательность которого намного длиннее – 3821 нуклеотидов между позициями 21 563 и 25 384 — – мы провели тест с двумя случайными фрагментами, выбранными в пределах этого гена: первым TTGGCAAAATTCAAGACTCACTTTC, что дало еще сотни микробных последовательностей и 93 последовательности из генома человека, и вторым CTTGCTGCTACTAAATGCAGAGTGT — и получили сто микробных последовательностей и 90 из человеческого генома.

Наконец, мы решили протестировать праймеры японского протокола — единственного, который включает целевые последовательности гена S и, читатель уже догадался, результаты снова оказались схожими: сто последовательностей микробов и 93 последовательности генома человека с процентом идентичности от 94,12% до 100%!


Последствия всего, что мы только что объяснили, однозначны и очевидны: ВАЛИДНОГО ТЕСТА ДЛЯ ОБНАРУЖЕНИЯ SARS-COV-2 НЕ СУЩЕСТВУЕТ — ни теста на антитела или антигены, ни ОТ-ПЦР. И мы включили те, что основаны на предполагаемом гене, который кодирует S1 или белок «шипов». А это значит, что ВСЕ ЧИСЛА «СЛУЧАЕВ», «ЗАРАЖЕННЫХ», «БОЛЬНЫХ», «БессимптомныХ» ИЛИ «УМЕРШИХ ИЗ-ЗА КОВИДА19» НЕ ИМЕЮТ ПОД СОБОЙ НАУЧНОЙ БАЗЫ И ЯВЛЯЮТСЯ ЛОЖНОПОЛОЖИТЕЛЬНЫМИ, о чем следует немедленно сообщить пострадавшим, а ответственные лица должны понести ответственность.

В заключение добавим, что даже сама ВОЗ не особо верит в эти тесты. Просто прочтите документ, опубликованный 11 сентября прошлого года в качестве лабораторного руководства по SARS-CoV-2 под названием « Диагностические тесты на SARS-CoV-2», доступный по адресу https://apps.who.int/iris/rest/bitstreams/1302661/retrive, где на странице 5 буквально сказано: «По возможности в случаях, подозрительных на активную инфекцию, необходим тест с использованием амплификации нуклеиновых кислот (NAAT), такого как ОТ-ПЦР. Тесты NAAT должны выявлять геном SARS-CoV-2, но поскольку неизвестны данные о глобальной циркуляции SARS-CoV-1, последовательность сарбековируса (предположительно включающая не менее пяти коронавирусов человека и животных, в том числе SARS-CoV-1 и SARS-Cov-2) также является разумной целевой мишенью». То есть, ВОЗ предлагает использовать для обнаружения SARS-CoV-2 неспецифические последовательности.

Это еще не все, так как в руководстве ниже говорится: «Оптимальная диагностика состоит из теста NAAT по крайней мере с двумя независимыми целевыми мишенями генома SARS-CoV-2; однако в районах, где инфекция широко распространена, можно использовать простой алгоритм с одной мишенью ».

В руководстве ВОЗ говорится: «Один или несколько отрицательных результатов не обязательно исключают инфекцию SARS-CoV-2. Существует ряд факторов, которыемогут привести к отрицательному результату у зараженного пациента, включая низкое качество пробы, позднее взятие пробы, ненадлежащее обращение или технические причины, присущие самой методике тестирования включая мутацию вируса или ингибирование ПЦР».

Чего ждут судьи, чтобы действовать по собственной инициативе?Хесус Гарсия Бланка

Автор перевода: @VseWeda (Валентина Кисилева)

5 1 оценка
Рейтинг статьи
Evgeniy Descov

Свежие посты

Основные аргументы против теории эволюции Дарвина и Новой Синтетической теории Эволюции (СТЭ).

Теория Химической Эволюции - это теория о происхождения жизни на Земле, которую выдвинул Александр Иванович… Читать далее..

3 месяца назад

Загадки Марианской впадины (Бездна Челленджера). Мистификация погружений.

О Впадине Марианская впадина - это самое глубокое место на Земле из известных на сегодняшний… Читать далее..

3 месяца назад

Ученые о “Теории” Дарвина

Предлагаем Вам насладится чтением, ниже опубликованной информацией, оформленной в виде высказываний известных ученых, в том… Читать далее..

3 месяца назад

Глобальный психоз, психо-информационный террор, как инструменты манипуляции сознанием.

Доклад члена Центрального совета ООД НПСР, участника альянса Народная солидарность, эксперта в области социально-политической психологии,… Читать далее..

3 месяца назад

Вирусы – это патогены? Или часть защитного ответа организма?

Странно слышать сентенции типа «вирус приспосабливается». В лучшем случае, это поэтическая метафора. Но многие ее… Читать далее..

4 месяца назад

Почему у одного и того же человека в разных клиниках показывает разные результаты ПЦР?

Причины ПЦР реакция не предназначена для определения инфекционного агента, даже если она найдет искомую последовательность,… Читать далее..

4 месяца назад

Данный сайт использует файлы cookies.